Fbp1 docs

Primers Seq for Screening FBP1 Gene:



Date added: January 12, 2017 - Views: 1

Supplementary Table 1 Sequence of primers used

FBP1 expression in gastric cancer cell lines and normal stomach tissues were determined by quantitative real-time RT-PCR as in Figure 2A.


Date added: September 1, 2016 - Views: 1


Tsc1-/-p53-/- MEFs were transduced with vector or plasmid encoding Flag-FBP1 and were analyzed by immunofluorescent staining with antibodies recognizing the Flag ...


Date added: January 12, 2017 - Views: 1


Hoffman CS, Winston F (1990) Isolation and characterization of mutants constitutive for expression of the fbp1 gene of . Schizosaccharomyces pombe.


Date added: February 23, 2017 - Views: 1

Table S1: Gene expression profiling in liver (A) and skeletal ...

Fbp1. B. NM_019395-2.47. 4.8E-02. Es1. NM_007954-2.47. 2.1E-02. Apof. NM_133997-2.49. 2.0E-02. Fga. NM_010196-2.49. 4.4E-02. Mbl2. B. NM_010776-2.50. 1.8E-02. Ambp. B ...


Date added: February 8, 2017 - Views: 1

Table 1 - Springer

Table Primer sequences for cDNA sequencing and exonamplification. Sequence. FBP1 cDNA seq 1 (sense) ACG TGT GTT CTC GTG TC FBP1 cDNA seq 2 (sense) AGC CGG CTA CGC ACT ...


Date added: January 12, 2017 - Views: 1

Exam #1 - Department of Biochemistry and Molecular Biology

... (FBP1) will be inactive. D) Pyruvate carboxylase will be active. E) The TCA (tricarboxylic acid cycle) enzyme malate dehydrogenase will favor the production of ...


Date added: August 31, 2016 - Views: 3

Table 6 - biology.unm.edu

FBP1. ATP18 NC NC NC ↑ 83% ± 50.0 ↑ 81% ± 32.1 ↑ 46% ± 26.8. Transcriptional repressor. Gluconeogenesis. ATP synthesisb aSaccharomyces Genome Database ...


Date added: February 23, 2017 - Views: 1

Strain - researchgate.net

Strain Genotype Origin SP14000 (WT) h- ade6-M210 leu1-32 ura4-D18 leu1-32 Lab. stock FWP87 h+ leu1-32 ura4::fbp1-lacZ fbp1::ura4+ C. Hoffman CHP984 h+ git3::KanR ...


Date added: January 12, 2017 - Views: 1

Quantitative Proteomic Profiling of Prostate Cancer Reveals a ...

... ENO1 IPI00465248 Isoform alpha-enolase of Alpha-enolase EZR IPI00746388 Ezrin FASN IPI00026781 Fatty acid synthase FBP1 IPI00073772 Fructose-1,6 ...


Date added: February 9, 2017 - Views: 1


... FBP1, C20orf54, GATA5; upregulated: PTPRN, PCSK1, PRLHR, CELSR3, GIPR, LMX1B, SCGN). Hypermethylation of . GIPR (gastric inhibitory polypeptide receptor) was ...


Date added: September 24, 2016 - Views: 2


Assistance in the operation of the system is provided by the Office of Financial Management. ... "FBP1" (press enter) (the BPS1 WELCOME/BROADCAST MESSAGE screen ...


Date added: August 20, 2016 - Views: 1

Table x - BioMed Central

↑actg2, ↑avpr2, ↑dab1, ↓fbp1, ↓kl, ↑penk, ↑rasgrf2, ↓s100g, ↓slc13a1, ↓smpdl3a, ↑stard13, ↑tpm1, ↑tubb2a,↑zbtb16


Date added: October 4, 2016 - Views: 1


Fbp1. Lsp1alpha. Lsp2. Down-regulated (n = 68) Aromatic Amino Acid Family Metabolic Process (GO:0009072) BP. 4 < 0.001. CG11796. Ddc. hgo. ple. Author: finn Created ...


Date added: February 23, 2017 - Views: 1


... (Santa Cruz), anti-FBP1 (CST) and β-actin (CST) overnight at 4°C. The membranes were washed three times and incubated with anti-Rabbit IgG-HRP (EarthOx).


Date added: August 23, 2016 - Views: 1

Table S2 - jvi.asm.org

... 5´oligonucleotide for PCR of 250 bp fbp1 product HL2024 AAGTGACGGCATAGGAACCG 3´oligonucleotide for PCR of 250 bp fbp1 product HL204 ...


Date added: January 12, 2017 - Views: 1

Supplementary material - cell.com

PMADS1/GP X69946 Interacts with FBP1 PhTM6 AF230704 NK [47,48] GLO ZMM16 AJ292959 Floral organ identity [40] GLO ZMM18 AJ292960 Floral organ identity [40]


Date added: August 28, 2016 - Views: 1

Table S2 - Oxford Journals

Table S2 Locus details and sequences of PCR primers used in this study. ... 6-bisphosphatase, intron 1 FBP1-1F FBP1-2R 5’-CAAGGTACTCCTTCACATCATCAGGAG.


Date added: September 24, 2016 - Views: 1


... wta dn di da 'htx-gal2' 0.0139 0.0146 0.0132 0.0136 0.0153 0.0128 'pfk1-2' 0.0153 0.0166 0.0173 0.0149 0.0203 0.0167 'fbp1' 0.0031 0.0035 0.0054 0.0027 0 ...


Date added: February 23, 2017 - Views: 1

Table S1 Summary of mapping results - plosone.org

... FBP1, VLDLR Pentose Phosphate Pathway 0.010 ALDOB, RGN, FBP1 Complement System 0.013 C8B, CFH, C8A Aryl Hydrocarbon Receptor Signaling 0.017 CCNE2, HSP90B1, ...


Date added: January 12, 2017 - Views: 1


fbp1. fosb. ormdl3. stox2. pigt. rnf186. mucl1. iqcg. tceal1. aqp1. hsd17b2. trim2. anxa9. gstm5. c7orf68. mthfd1l. kctd3. tpo. tmsb10. hrk. arl3. grasp. znf607 ...


Date added: October 3, 2016 - Views: 1

2012 12-Month Basic Calendar (any year)

FBP1. 7. 2. 3 . FBP1. 8. 4. 5. Type: Fall Practice. Time: 5:00-7:00. Location: Pelican Park. 2 nd Academic Check. Collect Forms. Type: Fall Practice. Time: 5:00-7:00 ...


Date added: August 28, 2016 - Views: 1


Mouse FBP1. Forward. 5′-CGCACAGCTCTATGGTATCG-3 ...


Date added: August 27, 2016 - Views: 10

Supplemental data 3: Assessment of the representation ...

... mig1 ams1 hxk2 gnd2 mal13 gre3 pfk26 gut2 suc2 sip4 fbp26 yjr096w ugp1 rgt1 mdh1 hap4 sdh3 sdh1 glg1 gsy2 pig1 aco1 fbp1 tsl1 pgm2 cat8 glc8 idp3 mls1 zwf1 ...


Date added: September 28, 2016 - Views: 1

Table S1 - Molecular & Cellular Proteomics

Table S2. Significant proteins ... liver 0.5 P09467 FBP1 Fructose-1,6-bisphosphatase 1 0.2 P35579 MYH9 Myosin-9 0.6 Q06830 PRDX1 Peroxiredoxin-1 0.6 E7EW08 SHMT1 ...


Date added: November 15, 2016 - Views: 1


CAT8, FBP1, MDH2, PCK1, PYC1, UBC8, VID24, VID30 “Autophagy ...


Date added: August 21, 2016 - Views: 3


abhd6, acot8, apeh, bai2, c12orf11, c14orf135, cln5, dera, fam86c, fbp1, fxyd7, gns, hnf4a, krt8, mipep, ...


Date added: September 24, 2016 - Views: 1

Essential roles of Cdc7 kinase in the progression of meiosis ...

In fission yeast, we detected the accumulation of Rec12-Flag by introducing rad50S mutation at mbs1 (hotspot) and fbp1 (control site) locus.


Date added: September 5, 2016 - Views: 12


Phase II - Hydrolases EPHX1 NM_000120 1,53 5,71 FBP1 NM_000507 -1,68 -2,07 FAAH NM_001441 2,01 1,29 Phase II - Kinases HK2 NM_000189 2,52 -1,09 PKM2 NM_002654 ...


Date added: August 27, 2016 - Views: 1


fbp1. cnga3. kcnh6. gata4. hpgd. cntnap5. kirrel2. gata5. krt19. crmp1. lmx1b. kcnq1. mosc2. dbndd1. mapk8ip2. ngef. mst1r. dscam. ptprn. pnliprp2. osr2. dync1i1. ret ...


Date added: October 7, 2016 - Views: 1


Fbp1. NM_019395.2. Forward. TCGCACAGCTCTATGGTATCG. 124. Reverse. AGAACACAGGTAGCGTAGGAC. G6pc. NM_008061.3. Forward. TGCAAGGGAGAACTCAGCAA. 145. Reverse ...


Date added: February 23, 2017 - Views: 1

Affymetrix ID - cell.com

... 1416726_s_at 6720465F12Rik 1416728_at Csnk2b 1416751_a_at Ddx20 1416756_at Dnajb1 1416792_at Ppm1g 1448470_at Fbp1 1416810_at Mea1 1431415_a_at Tbpl1 ...


Date added: October 4, 2016 - Views: 1

Molecular Subtypes of Breast Tumors and Cross-Validation ...

In addition, the Luminal/ER+ cluster contained many new biologically relevant genes such as AR (Figure 2C), FBP1 (a key enzyme in gluconeogenesis pathway) and BCMP11.


Date added: October 7, 2016 - Views: 1