Fbp1 docs

Searching:
doc
Primers Seq for Screening FBP1 Gene:

CTAAACTAAATCGCGTGGGC FBP1-F7 FBP1-R7 CACCAGCTCTGCATGTTTTG TCTGATTCATTGGGTTATTGTG Title: Primers Seq for Screening FBP1 Gene: Author: Fiaz Last modified by:

http://link.springer.com/content/esm/art:10.1007/s00431-009-0953-9/file/MediaObjects/431_2009_953_MOESM1_ESM.doc

Date added: January 12, 2017 - Views: 1

doc
Supplementary Table 1 Sequence of primers used

FBP1 expression in gastric cancer cell lines and normal stomach tissues were determined by quantitative real-time RT-PCR as in Figure 2A.

http://www.nature.com/onc/journal/v29/n3/extref/onc2009332x3.doc

Date added: September 1, 2016 - Views: 1

doc
www.nature.com

Tsc1-/-p53-/- MEFs were transduced with vector or plasmid encoding Flag-FBP1 and were analyzed by immunofluorescent staining with antibodies recognizing the Flag ...

http://www.nature.com/onc/journal/v30/n1/extref/onc2010404x6.doc

Date added: January 12, 2017 - Views: 1

doc
Table 1 - Springer

Table Primer sequences for cDNA sequencing and exonamplification. Sequence. FBP1 cDNA seq 1 (sense) ACG TGT GTT CTC GTG TC FBP1 cDNA seq 2 (sense) AGC CGG CTA CGC ACT ...

http://link.springer.com/content/esm/art:10.1007/s10545-009-9034-5/file/MediaObjects/10545_2009_9034_MOESM1_ESM.doc

Date added: January 12, 2017 - Views: 1

doc
Strain - researchgate.net

Strain Genotype Origin SP14000 (WT) h- ade6-M210 leu1-32 ura4-D18 leu1-32 Lab. stock FWP87 h+ leu1-32 ura4::fbp1-lacZ fbp1::ura4+ C. Hoffman CHP984 h+ git3::KanR ...

https://www.researchgate.net/profile/Gerardo_Ferbeyre/publication/293835650_Table_S1/links/56d3763a08ae059e376127ad?origin=publication_list

Date added: January 12, 2017 - Views: 1

doc
Table S2 - jvi.asm.org

... 5´oligonucleotide for PCR of 250 bp fbp1 product HL2024 AAGTGACGGCATAGGAACCG 3´oligonucleotide for PCR of 250 bp fbp1 product HL204 ...

http://jvi.asm.org/content/suppl/2009/02/13/83.6.2675.DC1/TableS2.doc

Date added: January 12, 2017 - Views: 1

doc
Table S2 - Oxford Journals

Table S2 Locus details and sequences of PCR primers used in this study. ... 6-bisphosphatase, intron 1 FBP1-1F FBP1-2R 5’-CAAGGTACTCCTTCACATCATCAGGAG.

http://mbe.oxfordjournals.org/content/suppl/2010/08/11/msq210.DC1/mbe-10-0198-File006.doc

Date added: September 24, 2016 - Views: 1

doc
Exam #1 - Department of Biochemistry and Molecular Biology

... (FBP1) will be inactive. D) Pyruvate carboxylase will be active. E) The TCA (tricarboxylic acid cycle) enzyme malate dehydrogenase will favor the production of ...

https://bmb.natsci.msu.edu/_bmb/assets/File/BMB514/B514ExamIIA%2010.doc

Date added: August 31, 2016 - Views: 2

doc
Table S1 Summary of mapping results - plosone.org

... FBP1, VLDLR Pentose Phosphate Pathway 0.010 ALDOB, RGN, FBP1 Complement System 0.013 C8B, CFH, C8A Aryl Hydrocarbon Receptor Signaling 0.017 CCNE2, HSP90B1, ...

http://www.plosone.org/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pone.0071782.s004

Date added: January 12, 2017 - Views: 1

doc
Table x - BioMed Central

↑actg2, ↑avpr2, ↑dab1, ↓fbp1, ↓kl, ↑penk, ↑rasgrf2, ↓s100g, ↓slc13a1, ↓smpdl3a, ↑stard13, ↑tpm1, ↑tubb2a,↑zbtb16

http://www.biomedcentral.com/content/supplementary/1756-0500-1-131-s9.doc

Date added: October 4, 2016 - Views: 1

doc
The biologically most active form of vitamin D, 1_,25 ...

2.51 fructose-1,6-bisphosphatase 1 FBP1 2.45 forkhead box F1 FOXF1 2.44 transketolase-like 1 TKTL1 2.44 CD300 molecule-like family member f CD300LF

http://www.biomedcentral.com/content/supplementary/1471-2407-13-119-s3.doc

Date added: August 19, 2016 - Views: 1

doc
2012 12-Month Basic Calendar (any year)

FBP1. 7. 2. 3 . FBP1. 8. 4. 5. Type: Fall Practice. Time: 5:00-7:00. Location: Pelican Park. 2 nd Academic Check. Collect Forms. Type: Fall Practice. Time: 5:00-7:00 ...

http://media.hometeamsonline.com/photos/lacrosse/CITADEL1406/2016-2017_Lacrosse_Calendar.docx

Date added: August 28, 2016 - Views: 1

doc
Table S4: Significant metabolism proteins whose expression is ...

Table S3: Significant metabolism proteins whose expression is modulated in nfHCC. Uniprot Gene Annotation Fold change O95831 AIFM1 Apoptosis-inducing factor 1 ...

http://www.mcponline.org/content/suppl/2014/09/15/M114.043174.DC1/mcp.M114.043174-4.doc

Date added: September 24, 2016 - Views: 1

doc
Supplemental data 3: Assessment of the representation ...

... mig1 ams1 hxk2 gnd2 mal13 gre3 pfk26 gut2 suc2 sip4 fbp26 yjr096w ugp1 rgt1 mdh1 hap4 sdh3 sdh1 glg1 gsy2 pig1 aco1 fbp1 tsl1 pgm2 cat8 glc8 idp3 mls1 zwf1 ...

http://msb.embopress.org/content/msb/2/1/49/DC4/embed/inline-supplementary-material-4.doc?download=true

Date added: September 28, 2016 - Views: 1

doc
Mascot Score - researchgate.net

... liver 840 Fbp1 Fbp1 Fructose bisphosphatase 1 123 Fmo2 Fmo2 Flavin-containing monooxygenase 2 267 Fmo3 Fmo3 Flavin containing monooxygenase 3 138 Ftl1 Ftl1 ...

https://www.researchgate.net/profile/Yan_Xu11/publication/294971303_Table_S3/data/56c7310808ae11063703465f/pone0016482s005.doc

Date added: January 12, 2017 - Views: 1

doc
OFFICE OF FINANCIAL MANAGEMENT - fortress.wa.gov

Office of Financial Management. Accounting Division. Budget Preparation System 1. USER'S OPERATIONS MANUAL. April 1994 I N T R O D U C T I O N.

https://fortress.wa.gov/ofm/classes/Reference/bps1.doc

Date added: August 20, 2016 - Views: 1

doc
annonc.oxfordjournals.org

fbp1. fosb. ormdl3. stox2. pigt. rnf186. mucl1. iqcg. tceal1. aqp1. hsd17b2. trim2. anxa9. gstm5. c7orf68. mthfd1l. kctd3. tpo. tmsb10. hrk. arl3. grasp. znf607 ...

http://annonc.oxfordjournals.org/content/suppl/2012/04/06/mds120.DC1/Supplementary_Table_2.docx

Date added: October 3, 2016 - Views: 1

doc
Table S1 - Molecular & Cellular Proteomics

Table S2. Significant proteins ... liver 0.5 P09467 FBP1 Fructose-1,6-bisphosphatase 1 0.2 P35579 MYH9 Myosin-9 0.6 Q06830 PRDX1 Peroxiredoxin-1 0.6 E7EW08 SHMT1 ...

http://www.mcponline.org/content/suppl/2014/09/15/M114.043174.DC1/mcp.M114.043174-3.doc

Date added: November 15, 2016 - Views: 1

doc
Essential roles of Cdc7 kinase in the progression of meiosis ...

In fission yeast, we detected the accumulation of Rec12-Flag by introducing rad50S mutation at mbs1 (hotspot) and fbp1 (control site) locus.

http://genesdev.cshlp.org/content/suppl/2008/02/05/22.3.398.DC1/SasanumaSuppFigureLegends.doc

Date added: September 5, 2016 - Views: 10

doc
mbio.asm.org

CAT8, FBP1, MDH2, PCK1, PYC1, UBC8, VID24, VID30 “Autophagy ...

http://mbio.asm.org/content/suppl/2015/04/09/mBio.00427-15.DCSupplemental/mbo002152283st2.docx

Date added: August 21, 2016 - Views: 3

doc
cancerres.aacrjournals.org

... (Santa Cruz), anti-FBP1 (CST) and β-actin (CST) overnight at 4°C. The membranes were washed three times and incubated with anti-Rabbit IgG-HRP (EarthOx).

http://cancerres.aacrjournals.org/content/suppl/2015/02/25/0008-5472.CAN-14-2615.DC1/137415_2_supp_0_njmcqn.docx

Date added: August 23, 2016 - Views: 1

doc
References

fbp1. 3,696865544. ymr206w. ymr206w. 3,676166551. yol052c-a. ddr2. 3,562564452. yjl052w. tdh1. 3,50985567. yhr092c. hxt4. 3,465944624. ymr081c. isf1. 3,253686294 ...

http://embor.embopress.org/content/embor/early/2016/10/31/embr.201642540/DC2/embed/inline-supplementary-material-2.docx?download=true

Date added: January 12, 2017 - Views: 1

doc
Chapter 1: Introduction - web.wpi.edu

FBP1. FBP1. A. B. 3kbz. line10359. A. 217. R->K # P20591. P20591. MX1. MX1. A. B. 3ljb. line21431. A. 379. V->I. Preserving. 0.98. Neutral. 0.97. P20827. P29317 ...

https://web.wpi.edu/Pubs/E-project/Available/E-project-103114-144505/unrestricted/MQP-Dongni_Zhang.docx

Date added: October 29, 2016 - Views: 1

doc
cancerres.aacrjournals.org

Mouse FBP1. Forward. 5′-CGCACAGCTCTATGGTATCG-3 ...

http://cancerres.aacrjournals.org/content/suppl/2015/02/25/0008-5472.CAN-14-2615.DC1/137415_2_supp_2830538_nbbbgr.docx

Date added: August 27, 2016 - Views: 9

doc
clincancerres.aacrjournals.org

fbp1. cnga3. kcnh6. gata4. hpgd. cntnap5. kirrel2. gata5. krt19. crmp1. lmx1b. kcnq1. mosc2. dbndd1. mapk8ip2. ngef. mst1r. dscam. ptprn. pnliprp2. osr2. dync1i1. ret ...

http://clincancerres.aacrjournals.org/content/suppl/2015/07/14/1078-0432.CCR-15-0373.DC1/145491_2_table_3034377_nq5cvp.docx

Date added: October 7, 2016 - Views: 1

doc
jac.oxfordjournals.org

Phase II - Hydrolases EPHX1 NM_000120 1,53 5,71 FBP1 NM_000507 -1,68 -2,07 FAAH NM_001441 2,01 1,29 Phase II - Kinases HK2 NM_000189 2,52 -1,09 PKM2 NM_002654 ...

http://jac.oxfordjournals.org/content/suppl/2013/07/27/dkt334.DC1/dkt334supp.doc

Date added: August 27, 2016 - Views: 1

doc
Affymetrix ID - cell.com

... 1416726_s_at 6720465F12Rik 1416728_at Csnk2b 1416751_a_at Ddx20 1416756_at Dnajb1 1416792_at Ppm1g 1448470_at Fbp1 1416810_at Mea1 1431415_a_at Tbpl1 ...

http://www.cell.com/cms/attachment/573467/4254582/mmc3.doc

Date added: October 4, 2016 - Views: 1

doc
Molecular Subtypes of Breast Tumors and Cross-Validation ...

In addition, the Luminal/ER+ cluster contained many new biologically relevant genes such as AR (Figure 2C), FBP1 (a key enzyme in gluconeogenesis pathway) and BCMP11.

http://www.unc.edu/~nobel/nobel/links/Papers/Intrinsic-conserved.doc

Date added: October 7, 2016 - Views: 1

doc
SeqID - Molecular Systems Biology

10 FBP1 > cauaCACAUAUAuau. 11 GRE3 > uauaCACAUAUAcag . 12 GSY2 > auucCACAUAUAuuu . 13 HXK1 > cacaCACAUAUAuau . 14 JEN1 > auuuCACAUAUAuuc . 15 MDH2 > cacaCACAUAUAuau ...

http://msb.embopress.org/content/msb/2/1/49/DC11/embed/inline-supplementary-material-11.doc?download=true

Date added: August 21, 2016 - Views: 1

doc
www.plosone.org

FBP1. PHI:733. reduced_vir. 29. FGSG_02324. AUR1. PHI:720. wild type vir. 30. FGSG_02328. GIP1. wild type vir. 31. FGSG_02395. PKS13. PHI:713. wild type vir. FGSG ...

http://www.plosone.org/article/fetchSingleRepresentation.action?uri=info:doi/10.1371/journal.pone.0067926.s007

Date added: October 2, 2016 - Views: 1

doc
Síntesis de Glucagón - Wikimedraz

FBP1 es responsable de la conversión de la fructosa- 1,6-bifosfato (F (1,6) P2) en fructosa-6-fosfato (F6P). Su actividad está regulada por el glucagón ya que, ...

http://wikimedraz.wikispaces.com/file/view/Resumen.+secrecionde+glucagon.doc

Date added: August 21, 2016 - Views: 4

doc
s3-eu-west-1.amazonaws.com

... ACAGCAATGCCTGACAAGACT (mouse) FBP1 fructose-1,6-bisphosphatase 1 F: CCCCAGATAATTCAGCTCCTTA ...

https://s3-eu-west-1.amazonaws.com/pstorage-plos-3567654/324329/Table_S1.doc

Date added: September 24, 2016 - Views: 1

doc
genome.cshlp.org

abhd6, acot8, apeh, bai2, c12orf11, c14orf135, cln5, dera, fam86c, fbp1, fxyd7, gns, hnf4a, krt8, mipep, ...

http://genome.cshlp.org/content/suppl/2010/03/01/gr.101956.109.DC1/Supplementary_Table_9.docx

Date added: September 24, 2016 - Views: 1

doc
www.pnas.org

FBP1,FBP2. Type I Diabetes Mellitus Signaling. 8.44E-01. 4.13E-02. RELA,JAK1,RIPK1,CD86,HLA-DOB. B Cell Development. 8.29E-01. 5.56E-02. CD86,HLA-DOB. Xenobiotic ...

http://www.pnas.org/content/suppl/2015/04/02/1504780112.DCSupplemental/pnas.1504780112.st01.docx

Date added: August 21, 2016 - Views: 1

doc
erpsapbi.weebly.com

FBP1 Enter Payment Request. FBR1 Post with Reference Document: Header Data. FBR2 Post Document: Header Data. FBRA Reset Cleared Items. FBRC Reverse clearing with ...

http://erpsapbi.weebly.com/uploads/1/7/1/9/17197490/sap_transaction.docx

Date added: August 18, 2016 - Views: 6

doc
References

fbp1. up. yjl161w. fmp33. up. yor178c. gac1. up. ymr250w. gad1. up. ypr184w. gdb1. up. yel011w. glc3. up. ykr058w. glg1. up. ycl040w. glk1. up. yor348c. gor1. up ...

http://embor.embopress.org/content/embor/early/2016/10/31/embr.201642540/DC4/embed/inline-supplementary-material-4.docx?download=true

Date added: January 12, 2017 - Views: 1

doc
Genetic variation in Native Americans - mbe.oxfordjournals.org

Supplementary Tables and Figures for “Genetic variation in Native Americans, ... 8, 10, 14, 15, 17, 20, 22 1, 9, 13, 21 FBP1 4, 11, 14, 19, 21 1, 5, 7, 8, 13 ...

http://mbe.oxfordjournals.org/content/suppl/2011/07/26/msr049.DC1/MBE-11-0038_supp.doc

Date added: October 16, 2016 - Views: 1

doc
cser-consortium.org

Patient Results: No known pathogenic or likely pathogenic variants detected. Interpretation: A sample from this individual (Subject ID) was referred to our laboratory ...

https://cser-consortium.org/system/files/attachments/negative_carrier_template_11-6-2015.docx

Date added: August 20, 2016 - Views: 2

doc
www.fbportsmouth.com

RFP#FBP14SC31553 . OSWDF Noise Study Services. RFP#FBP1. 4SC31553 . OSWDF Noise Study Services. RFP#FBP1. 4SC31553 . OSWDF Noise Study Services. RFP#FBP1. 4SC31553 ...

http://www.fbportsmouth.com/docs/Solicitations/Noise%20Study%20Services/2%20TAB%20B3%20%20%20FBP%20Noise%20Study%20Rev%20%2016%20%20Addenda%201%20Version.docx

Date added: August 19, 2016 - Views: 3

doc
Characterization of the changes in gene expression in the ...

... 0,14 dpp4 0,14 q96me0 0,13 garnl3 0,13 psen2 0,13 hmgcs2 0,13 hgd 0,12 fbp1 0,11 abcd3 0,11 cyp4f2 0,11 abcd3 0,11 slc17a1 ...

http://download.lww.com/wolterskluwer_vitalstream_com/PermaLink/SHK/A/SHK_34_4_2010_05_11_VANMALENSTEIN_201297_SDC1.doc

Date added: August 26, 2016 - Views: 1

doc
fbportsmouth.com

RFP#FBP14SC34181. X-120 Meteorological Tower Inspection and Painting. RFP#FBP1. 4SC34181. X-120 Meteorological Tower Inspection and Painting. RFP#FBP1. 4SC34181. X ...

http://fbportsmouth.com/docs/Solicitations/Weather%20Tower/1%20TAB%20B1%2014SC334181%20Request%20for%20Proposal%20Rev%202%20RFP.docx

Date added: August 19, 2016 - Views: 3

doc
static-content.springer.com

Supplementary Table 2. Entire kidney proteome. prot_acc. prot_desc. prot_ score. prot_ mass. prot_ matches. IPI00551812. Atp5b ATP synthase subunit beta ...

https://static-content.springer.com/esm/art%3A10.1007%2Fs10157-012-0708-1/MediaObjects/10157_2012_708_MOESM2_ESM.docx

Date added: November 30, 2016 - Views: 1

doc
Asper Ophthalmics Interpretation Order form - asperbio.com

cox6b1, cpt1a, cpt2, dars2, dguok, dlat, dld, dnajc19, dnm1l, etfa, etfb, etfdh, ethe1, fastkd2, fbp1, fh, foxred1, g6pc, gamt, gatm, gfer, gfm1, gys2, ...

http://www.asperbio.com/wp-content/uploads/Asper-Neurogenetics-saatekiri.doc

Date added: September 2, 2016 - Views: 1

doc
repository.unhas.ac.id

Promoter -aktin ikan mas (ccBA) diisolasi menggunakan metode PCR dengan primer FBP1, RBP1, dan RBP2. Sequensing dilakukan dengan menggunakan mesin ABI PRISM 3100, ...

http://repository.unhas.ac.id/bitstream/handle/123456789/2179/ANALISIS%20FUNGSIONAL%20DAN%20KLONING%20PROMOTER.docx?sequence=1

Date added: September 18, 2016 - Views: 1

doc
Supplementary Table 3: List of lineage-selective essential ...

Title: Supplementary Table 3: List of lineage-selective essential genes that are altered in respective cancer type Author: Theresa Wang Last modified by

http://www.pnas.org/content/suppl/2011/07/07/1109363108.DCSupplemental/st03.doc

Date added: August 18, 2016 - Views: 1

doc
clinchem.aaccjnls.org

... fructose-bisphosphate Underexpressed 9 3 12 ACAT1 acetyl-CoAacetyltransferase 1 Underexpressed 8 3 11 FBP1 fructose-1,6-bisphosphatase 1 Underexpressed 10 1 ...

http://clinchem.aaccjnls.org/content/suppl/2014/07/18/clinchem.2014.225854.DC1/clinchem.2014.225854-2.doc

Date added: January 12, 2017 - Views: 1

doc
Egenprovningsprotokoll Komponent

FBP1/2 X=Utan anmärkn. O=Fel eller brist (=Åtgärdat Ordernummer. X580096 Utfärdat av. H Gruce Benämning komponent Mon-tage Install. ation Funk-tion Märk-

http://m1.laholm.se/~frank.bylund/files/FOV8-0002633D/FOV8-0002634D/FBP1_2%20Komponent.doc

Date added: October 31, 2016 - Views: 1

doc
Supplementary Table 4 - genome.cshlp.org

... crot epn2 cdc42ep3 cryz erbb2ip cdh7 csdc2 erbb3 cdh8 cspg5 evi2a cdh9 cst3 fa2h cdk5r1 ctbp2 fbn2 cdkl1 ctbs fbp1 cdkl2 cth fbxl5 cdkn1a ctnnd2 fbxo7 ...

http://genome.cshlp.org/content/suppl/2010/03/01/gr.101956.109.DC1/Supplementary_Table_5.doc

Date added: August 18, 2016 - Views: 1

doc
Skyltlista 1

fbp1 fastbrÄnslepanna antal skyltstorlek ..... x ..... mm mm silo-as1 brÄnslesilo antal skyltstorlek ..... x ...

http://m1.laholm.se/~frank.bylund/FOV8-0002057C/FOV8-0002633D/FOV8-0002634E/Skyltlista%201.doc

Date added: August 28, 2016 - Views: 1